Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ _001640 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Early-Stage Lung Adenocarcinoma | ICD-10 | Bronchus and lung (D02.2) |
DBLink | Link to database | PMID | 29241190 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 4 tumors and paired adjacent normal tissue from non-smoking patients with lung adenocarcinoma |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GATCGGAAGACTGATTCTGCTG ReverseCTTAGATGGCACCGAATACAGC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Zhao, J, Li, L, Wang, Q, Han, H, Zhan, Q, Xu, M (2017). CircRNA Expression Profile in Early-Stage Lung Adenocarcinoma Patients. Cell. Physiol. Biochem., 44, 6:2138-2146. |